PCAGGS- HA
In stock
SKU/Catalog Number
PVT1021
Catalog Number: PVT1021
- pCAGGS-HA Information:
- Promoter: CAG promoter.
- Replicator: SV40 ori, ori.
- Plasmid classification: lactation serial plasmid; lactation expression plasmid; pCAG series plasmid.
- Plasmid size: 4807bp.
- Prokaryotic resistance: ampicillin Amp (100 u g/ml).
- Cloned strains of Escherichia coli, DH5 A and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic, LB.
- Expression host: mammalian cells such as 293T.
- Culture conditions: 37 C, 5%CO2.
- Induction mode: no induction.
- 5'sequencing primers: pcaggs-F (GCTAACCATGTTCATGCCTTCT).
- 3'sequencing primers: pcaggs-R (TATGTCCTTCCGAGTGAGAG).
- pCAGGS-HA Description:
- pCAGGS-HA is added with HA tag on the basis of pCAGGS vector, which is helpful to detect antibody in WB test. pCAGGS-HA plasmid is useful for highly efficient expression of genes under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.When cloning a fragment downstream from the lac promoter it may be advisable to use lacIq strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
Company | bioactiva diagnostica GmbH |
---|---|
Product Number | PVT1021 |
Manufacturer | Life Science Market |
Certification | For research only |
Order | Request Quote |