PCAGGS
In stock
SKU/Catalog Number
PVT1020
Catalog Number: PVT1020
- pCAGGS Information:
- Promoter: CAG promoter.
- Replicator: SV40 ori, ori.
- Terminator: beta -globin poly (A) signal.
- Plasmid classification: lactation serial plasmid; lactation expression plasmid; pCAG series plasmid. Plasmid size: 4801bp.
- Prokaryotic resistance: ampicillin Amp (100 u g/ml).
- Cloned strains of Escherichia coli, DH5 A and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic, LB.
- Expression host: mammalian cells such as 293T.
- Culture conditions: 37 C, 5%CO2.
- Induction mode: no induction, instantaneous expression.
- 5'sequencing primers: pcaggs-F (GTTCGGCTTCTGGCGTGT).
- 3'sequencing primers: pcaggs-R (TATGTCCTTCCGAGTGAGAG).
Company | bioactiva diagnostica GmbH |
---|---|
Product Number | PVT1020 |
Manufacturer | Life Science Market |
Certification | For research only |
Order | Request Quote |