PCAG- GFP PLASMID
In stock
SKU/Catalog Number
PVT1036
Catalog Number: PVT1036
- pCAG-GFP Information:
- Promoter: CAG promoter.
- Replicon: ori, SV40 ori.
- Terminator: β-globin poly(A) signal.
- Plasmid Category: Breast-feeding Plasmids; Mammalian Expression Plasmids; pCAG Plasmids.
- Plasmid Size: 5556bp.
- Prokaryotic resistance: Ampicillin Amp (100 μg/ml).
- Filtering Marker: C-EGFP.
- Cloning strains: E. coli DH5α.
- Culture conditions: 37°C, aerobic, LB.
- Expression host: 293T and other mammalian cells.
- Culture conditions: 37°C, 5% CO2.
- Induction mode: No induction, transient expression.
- 5' Sequencing Primer: PCAG-F (GCAACGTGCTGGTTATTGTG).
- 3' Sequencing Primer: β-globin-R (GTCCTTCCGAGTGAGAGACAC).
- pCAG-GFP Desciption:
- pCAG-GFP is a plasmid that can be expressed in mammalian cells. The CAG promoter drives the fusion expression of the target gene and the green fluorescent protein EGFP, and can be cloned into the desired gene using EcoRI, KpnI, and XmaI restriction sites.
Size | 2ug |
---|---|
Company | bioactiva diagnostica GmbH |
Product Number | PVT1036 |
Manufacturer | Life Science Market |
Certification | For research only |
Order | Request Quote |