PBLUESCRIPT II KS+ PLASMID
In stock
SKU/Catalog Number
PVT0012
Catalog Number: PVT0012
- pBluescript II-KS(+) Plasmid Informaiton.
- Function E.coli Cloning plasmid.
- Replicator: ColE1 ori, F1 ori.
- Plasmid classification: large intestine series plasmid; large intestine clone plasmid; phage display plasmid.
- Plasmid size: 2961bp.
- Plasmid label: LacZ.
- Prokaryotic resistance: ampicillin Amp (100 u g/ml).
- Cloned strains of Escherichia coli, DH5 A and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic, LB.
- 5'sequencing primers: T7 (TAATACGACTCACTATAGGG).
- 3'sequencing primers: T3 (ATTAACCCTCACTAAAGGGA).
- Note: Blue leukoplakia screening, producing single strand DNA.
Size | 2ug |
---|---|
Company | bioactiva diagnostica GmbH |
Product Number | PVT0012 |
Manufacturer | Life Science Market |
Certification | For research only |
Order | Request Quote |