PBAD24

In stock
SKU/Catalog Number
PVT0709

Catalog Number: PVT0709

  • pBAD24 Information:
  • Promoter: araBAD.
  • Replicator: ori, F1 ori.
  • Terminator: rrnB T1 Terminator.
  • Plasmid classification: large intestine plasmid; large intestine expression plasmid; pBAD series plasmid.
  • Plasmid size: 4542bp.
  • Plasmid label: N-His, N-EK, N-Xpress.
  • Prokaryotic resistance: ampicillin Amp (100 u g/ml).
  • Cloned strains of Escherichia coli, Top10 and other Escherichia coli.
  • Culture conditions: 37 centigrade, aerobic, LB.
  • Expression of host: LMG194 and other Escherichia coli.
  • Culture conditions: 37 centigrade, aerobic, LB.
  • Inducement: Arabia sugar.
  • 5'sequencing primers: PBAD30.F (AGATTAGCGGATCCTACCTG).
  • 3'sequencing primers: PBAD30.R (CACTTCTGAGTTCGGCATGG).
  • pBAD24 Description:
  • PBAD24 is derived from pBR322 vectors. The vector is designed to express and purify recombinant target protein in Escherichia coli in a dose-dependent manner. The E.coli araBAD promoter (pBAD) enhanced the soluble expression level of E.coli recombinant protein. Regulatory proteins AraC on pBAD/His and pBAD/Myc-His vectors can regulate pBad promoter.
More Information
Size2ug
Companybioactiva diagnostica GmbH
Product NumberPVT0709
ManufacturerLife Science Market
CertificationFor research only
OrderRequest Quote