PBAD- HISA
In stock
SKU/Catalog Number
PVT10606
Catalog Number: PVT10606
- pBAD-HisA Information:
- Function E.coli expression plasmid.
- Promoter: araBAD promoter.
- Replicon: pBR322 ori.
- Terminator: rrnB T1 Terminator.
- Plasmid classification: large intestine plasmid; large intestine expression plasmid; pBAD series plasmid.
- Plasmid size: 4102bp.
- Plasmid label: N-His, N-EK, N-xPress Epitope.
- Prokaryotic resistance: ampicillin Amp.
- Cloned strains of Escherichia coli, Top10 and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic, LB.
- Expression of host: LMG194 and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic, LB.
- Inducement: Arabia sugar.
- 5'sequencing primers: PBAD30.F (AGATTAGCGGATCCTACCTG).
- 3'sequencing primers: PBAD30.R (CACTTCTGAGTTCGGCATGG).
| Size | 2ug |
|---|---|
| Company | bioactiva diagnostica GmbH |
| Product Number | PVT10606 |
| Manufacturer | Life Science Market |
| Certification | For research only |
| Order | Request Quote |


