PBAD/HIS B
In stock
SKU/Catalog Number
PVTY00913
Catalog Number: PVTY00913
- pBAD/His B Description:
- Plasmid type:E.coli Expression.
- VectorCopy number:High.
- copyPromoter:araBadCloning.
- Method:Multiple cloning sites,restriction endonucleaseSize:4092 bp 5' Sequencing primers and sequences:pBAD-F: ATGCCATAGCATTTTTATCC3' Sequencing primers and sequences:pBAD-R: gatttaatctgtatcaggTags:N-His, N-EKResistance(s):Ampicillin (Amp).
- Caution: 1. This product is FOR RESEARCH USE ONLY.
| Company | bioactiva diagnostica GmbH |
|---|---|
| Product Number | PVTY00913 |
| Manufacturer | Life Science Market |
| Certification | For research only |
| Order | Request Quote |
