PBAD/HIS A
In stock
SKU/Catalog Number
PVTY00912
Catalog Number: PVTY00912
- pBAD/His A Description:
- Plasmid type:E.coli Expression.
- VectorCopy number:High.
- copyPromoter:araBadCloning.
- Method:Multiple cloning.
- sites,restriction endonucleaseSize:4102 bp 5' Sequencing primers and sequences:pBAD-F: ATGCCATAGCATTTTTATCC3' Sequencing primers and sequences:pBAD-R: gatttaatctgtatcaggTags:N-His, N-EKResistance(s):Ampicillin (Amp).
- Caution: 1. This product is FOR RESEARCH USE ONLY.
| Company | bioactiva diagnostica GmbH |
|---|---|
| Product Number | PVTY00912 |
| Manufacturer | Life Science Market |
| Certification | For research only |
| Order | Request Quote |
