pAX01
In stock
SKU/Catalog Number
PVT5010
Catalog Number: PVT5010
- pAX01 Information.
- Promoter: xylA promoter.
- Replicon: ColE1 ori.
- Terminator: T1 terminator, T2 Terminator.
- Plasmid classification: hay series plasmid, hay integration plasmid, plasmid in hay.
- Plasmid size: 7781bp.
- Prokaryotic resistance: ampicillin Amp (100 u g/ml).
- Screening markers: erythromycin ERM.
- Cloned strains of Escherichia coli, DH5 A and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic LB.
- Expression host: Bacillus subtilis, BS168 and other Bacillus subtilis.
- Inducement: xylose induction.
- 5'sequencing primers: pAX-F (GTTGCCCTGGAGACAGGGG).
- 3'sequencing primers: pAX-R (GATATGGTGCAAGTCAGCACG).
- Use: Bacillus subtilis.
Size | 2ug |
---|---|
Company | bioactiva diagnostica GmbH |
Product Number | PVT5010 |
Manufacturer | Life Science Market |
Certification | For research only |
Order | Request Quote |