pACYCDuet- 1 Plasmid
In stock
SKU/Catalog Number
PVT0102
Catalog Number: PVT0102
- pACYCDuet-1 plasmid information.
- Promoter: T7/Lac.
- Replicon: p15A ori.
- Terminator: T7 Terminator.
- Plasmid classification: large intestine series plasmid; other large intestine plasmid; large intestine double frame plasmid.
- Plasmid size: 4008bp.
- Plasmid Tags: N-6 x His, C-S.
- Prokaryotic resistance: chloramphenicol Chl (50 g/ml).
- Clone strain: DH5 alpha and other Escherichia coli.
- Culture conditions: 37, aerobic, LB.
- Expression host: BL21 (DE3) and other Escherichia coli.
- Culture conditions: 37, aerobic, LB.
- Induction: IPTG or lactose and its analogues.
- Primers for 5'sequencing: ACYCDuetUP1 (GGATCTCGACGCTCTCCCT) DuetUP2 (TTGTACACGGCCGCATAATC).
- Caution: Product is for research use only.
- Search name pACYCDuet-1,Plasmid pACYCDuet-1,pACYCDuet-1 vector.
| Size | 2ug |
|---|---|
| Company | bioactiva diagnostica GmbH |
| Product Number | PVT0102 |
| Manufacturer | Life Science Market |
| Certification | For research only |
| Order | Request Quote |


