pACGFP1- N1 Plasmid
In stock
SKU/Catalog Number
PVT1211
Catalog Number: PVT1211
- pACGFP1-N1 plasmid Information:
- Promoter: CMV promoter.
- Replicon: pUC ori, F1 ori.
- Terminator: SV40 poly (A) signal.
- Plasmid classification: lactation serial plasmids; lactating fluorescent plasmid; lactation green plasmid.
- Plasmid size: 4726bp.
- Plasmid tagging: C-GFP.
- Prokaryotic resistance: kanamycin Kan (50 g/ml).
- Screening marker: neomycin Neo/G418.
- Cloning strains: E. coli DH5 and E.
- Culture conditions: 37 C, aerobic LB.
- Expression host: mammalian cells such as 293T.
- Culture conditions: 37 C, 5%CO2.
- Induction mode: no need to induce, transient expression.
- 5'sequencing primers: CMV-F (CGCAAATGGGCGGTAGGCGTG).
- 3'sequencing primers: Sv40-polyA-R (GAAATTTGTGATGCTATTGC).
| Size | 2ug |
|---|---|
| Company | bioactiva diagnostica GmbH |
| Product Number | PVT1211 |
| Manufacturer | Life Science Market |
| Certification | For research only |
| Order | Request Quote |


