FUGW
In stock
SKU/Catalog Number
PVTY00634
Catalog Number: PVTY00634
Plasmid type: Lentiviral vector Copy Number: High copy Promoter: hUbc Cloning Method: Multiple cloning sites,restriction endonuclease Size: 9941 bp 5' Sequencing primers and sequences: hUBCpro-F: ? TGAAGCTCCGGTTTTGAACT 3' Sequencing primers and sequences: EGFP-N: CGTCGCCGTCCAGCTCGACCAG Tags: C-EGFP Resistance(s): Ampicillin (Amp) Note: Stbl3 competent cells were used to amplify the plasmid, which could reduce the probability of gene recombination
Size | 2ug |
---|---|
Company | bioactiva diagnostica GmbH |
Product Number | PVTY00634 |
Manufacturer | Life Science Market |
Certification | For research only |
Order | Request Quote |