FUGW

Plasmid type: Lentiviral vector Copy Number: High copy Promoter: hUbc Cloning Method: Multiple cloning sites,restriction endonuclease Size: 9941 bp 5' Sequencing primers and sequences: hUBCpro-F: ? TGAAGCTCCGGTTTTGAACT 3' Sequencing primers and sequences: EGFP-N: CGTCGCCGTCCAGCTCGACCAG Tags: C-EGFP Resistance(s): Ampicillin (Amp) Note: Stbl3 competent cells were used to amplify the plasmid, which could reduce the probability of gene recombination