ABAI
In stock
SKU/Catalog Number
PVT4023
Catalog Number: PVT4023
- Promoter: URA3.
- Replicon: pUC ori.
- Plasmid classification: yeast series plasmids; yeast hybrid plasmids; single hybrid plasmids.
- Plasmid size: 4944bp.
- Prokaryotic resistance: ampicillin Amp (100 u g/ml).
- Screening markers: URA3.
- Cloned strains of Escherichia coli, DH5 A and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic LB.
- Expression host: Y1Hgold and other yeast.
- Culture conditions: 30 centigrade, YPDA, aerobic.
- 5'sequencing primers: pABAI-F (GTTCCTTATATGTAGCTTTCGACA).
- 3'sequencing primers: pABAI-R (CCATCTCGAAAAAGGGTTTGCC).
- Remarks: low copy plasmids.
- Use: Yeast expression.
| Company | bioactiva diagnostica GmbH |
|---|---|
| Product Number | PVT4023 |
| Manufacturer | Life Science Market |
| Certification | For research only |
| Order | Request Quote |
