ABAI

In stock
SKU/Catalog Number
PVT4023

Catalog Number: PVT4023

  • Promoter: URA3.
  • Replicon: pUC ori.
  • Plasmid classification: yeast series plasmids; yeast hybrid plasmids; single hybrid plasmids.
  • Plasmid size: 4944bp.
  • Prokaryotic resistance: ampicillin Amp (100 u g/ml).
  • Screening markers: URA3.
  • Cloned strains of Escherichia coli, DH5 A and other Escherichia coli.
  • Culture conditions: 37 centigrade, aerobic LB.
  • Expression host: Y1Hgold and other yeast.
  • Culture conditions: 30 centigrade, YPDA, aerobic.
  • 5'sequencing primers: pABAI-F (GTTCCTTATATGTAGCTTTCGACA).
  • 3'sequencing primers: pABAI-R (CCATCTCGAAAAAGGGTTTGCC).
  • Remarks: low copy plasmids.
  • Use: Yeast expression.
More Information
Size2ug
Companybioactiva diagnostica GmbH
Product NumberPVT4023
ManufacturerLife Science Market
CertificationFor research only
OrderRequest Quote