PBAD24
Auf Lager
SKU/Catalog Number
PVT0709
Katalognummer: PVT0709
- pBAD24 Information:
- Promoter: araBAD.
- Replicator: ori, F1 ori.
- Terminator: rrnB T1 Terminator.
- Plasmid classification: large intestine plasmid; large intestine expression plasmid; pBAD series plasmid.
- Plasmid size: 4542bp.
- Plasmid label: N-His, N-EK, N-Xpress.
- Prokaryotic resistance: ampicillin Amp (100 u g/ml).
- Cloned strains of Escherichia coli, Top10 and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic, LB.
- Expression of host: LMG194 and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic, LB.
- Inducement: Arabia sugar.
- 5'sequencing primers: PBAD30.F (AGATTAGCGGATCCTACCTG).
- 3'sequencing primers: PBAD30.R (CACTTCTGAGTTCGGCATGG).
- pBAD24 Description:
- PBAD24 is derived from pBR322 vectors. The vector is designed to express and purify recombinant target protein in Escherichia coli in a dose-dependent manner. The E.coli araBAD promoter (pBAD) enhanced the soluble expression level of E.coli recombinant protein. Regulatory proteins AraC on pBAD/His and pBAD/Myc-His vectors can regulate pBad promoter.
| Size | 2ug |
|---|---|
| Company | bioactiva diagnostica GmbH |
| Product Number | PVT0709 |
| Hersteller | Life Science Market |
| Zertifizierung | For research only |
| Order | Request Quote |


