PBAD/GIII B
Auf Lager
SKU/Catalog Number
PVTY00910
Katalognummer: PVTY00910
- pBad/gIII B Description:
- Plasmid type:E.coli Expression.
- VectorCopy number:High.
- copyPromoter:araBadCloning.
- Method:Multiple cloning.
- sites,restriction.
- endonucleaseSize:4147 bp 5'.
- Sequencing primers and sequences:pBAD-F:
- ATGCCATAGCATTTTTATCC3' Sequencing primers and sequences:pBAD-R: gatttaatctgtatcaggTags:N-GIII signal, C-His, C-MycResistance(s):Ampicillin (Amp).
- Caution: 1. This product is FOR RESEARCH USE ONLY.
| Company | bioactiva diagnostica GmbH |
|---|---|
| Product Number | PVTY00910 |
| Hersteller | Life Science Market |
| Zertifizierung | For research only |
| Order | Request Quote |
