pAX01

Auf Lager
SKU/Catalog Number
PVT5010

Katalognummer: PVT5010

  • pAX01 Information.
  • Promoter: xylA promoter.
  • Replicon: ColE1 ori.
  • Terminator: T1 terminator, T2 Terminator.
  • Plasmid classification: hay series plasmid, hay integration plasmid, plasmid in hay.
  • Plasmid size: 7781bp.
  • Prokaryotic resistance: ampicillin Amp (100 u g/ml).
  • Screening markers: erythromycin ERM.
  • Cloned strains of Escherichia coli, DH5 A and other Escherichia coli.
  • Culture conditions: 37 centigrade, aerobic LB.
  • Expression host: Bacillus subtilis, BS168 and other Bacillus subtilis.
  • Inducement: xylose induction.
  • 5'sequencing primers: pAX-F (GTTGCCCTGGAGACAGGGG).
  • 3'sequencing primers: pAX-R (GATATGGTGCAAGTCAGCACG).
  • Use: Bacillus subtilis.
Weitere Informationen
Size2ug
Companybioactiva diagnostica GmbH
Product NumberPVT5010
HerstellerLife Science Market
ZertifizierungFor research only
OrderRequest Quote