pABAI Plasmid
Auf Lager
SKU/Catalog Number
PVT4022
Katalognummer: PVT4022
- pABAI Plasmid Information.
- Promoter: URA3 promoter.
- Replicon: ColE1 ori.
- Plasmid classification: yeast series plasmids; yeast hybrid plasmids; single hybrid plasmids.
- Plasmid size: 4894bp.
- Prokaryotic resistance: ampicillin Amp (100 u g/ml).
- Screening markers: URA3.
- Cloned strains of Escherichia coli, DH5 A and other Escherichia coli.
- Culture conditions: 37 centigrade, aerobic, LB.
- Expression host: Y1Hgold and other yeast.
- Culture conditions: 30 centigrade, YPDA, aerobic.
- 5'sequencing primers: pABAI-F (GTTCCTTATATGTAGCTTTCGACA).
- 3'sequencing primers: pABAI-R (CCATCTCGAAAAAGGGTTTGCC).
- Remarks: low copy plasmids.
- Use: Yeast expression.
Size | 2ug |
---|---|
Company | bioactiva diagnostica GmbH |
Product Number | PVT4022 |
Hersteller | Life Science Market |
Zertifizierung | For research only |
Order | Request Quote |